rs3026883 chr1:21255486 C>A
- Sequence
taacgccctgttgtacagtgagcc[C/A]atctgcggctggctcctctgccac
- ASB in cell types
- K562 (myelogenous leukemia) hepatocytes
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.82 | 0.61 | 1.09 | |||
| hepatocytes | -0.80 | 1.45 | 1.00 |
Items per page:
1 – 2 of 2