rs303061 chr6:10429938 T>C
- Sequence
aaacagcccagtgttggtagaaag[T/C]accagagacagggcggggaagcag
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) 2588 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.26 | 0.92 | 1.12 | |||
| 2588 (Lymphoblastoid Cell Lines) | -0.63 | 0.66 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP autism, chronic kidney disease, cystatin c in serum, prop taste detection threshold, refractive error, serum creatinine, total cholesterol