rs303525 chr10:88810547 G>A
- Sequence
aaaattcaccaaccaagaaagcca[G/A]tgaaattcttattgaaaacaactg
- ASB in cell types
- T47D (invasive ductal carcinoma) HeLa (cervical adenocarcinoma) PANC1 (pancreatic ductal adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| T47D (invasive ductal carcinoma) | 1.49 | 0.82 | 1.05 | |||
| HeLa (cervical adenocarcinoma) | 0.79 | 1.75 | 2.00 | |||
| PANC1 (pancreatic ductal adenocarcinoma) | 1.11 | -0.34 | 1.00 |
Items per page:
1 – 3 of 3