rs305010 chr15:69853872 A>G
- Sequence
aatgcaatataatgggacaccagc[A/G]taagaggccaactgtttcctttgc
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells)
- ASB for transcription factors
- TF65_HUMAN SMCA4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TF65_HUMAN | 2.34 | n/a | 3.00 | n/a | No Hit | |||
| SMCA4_HUMAN | -0.97 | 1.36 | 1.80 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, comorbid depressive syndrome and alcohol dependence, cystatin c in serum, hdl cholesterol, maternal transmission distortion, rheumatoid arthritis