rs305064 chr16:85940536 T>C
- Sequence
acagtgctgtgaggtcatcattat[T/C]gtcattcccatgttacagatgagg
- ASB in cell types
- renal cortex
- ASB for transcription factors
- CREB1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CREB1_HUMAN | -2.11 | 2.50 | 1.00 | 4.26 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP college completion, ldl cholesterol, ldl cholesterol change with statins, total cholesterol change with statins, urinary albumin-to-creatinine ratio