rs307415 chr8:141602954 G>A
- Sequence
gcgcagctgggccgtcagagtctc[G/A]cagctcccgggtgtgaaatggaga
- ASB in cell types
- HS-SY-2(Monophasic synovial sarcoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HS-SY-2(Monophasic synovial sarcoma) | 1.43 | 0.07 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, chronic kidney disease, prop taste detection threshold, tardive dyskinesia