rs307896 chr19:47158236 G>A
- Sequence
actttgtgctcctaaattagtaac[G/A]ttgaaaaacaaaaaggaaaaacag
- ASB in cell types
- 22RV1 (prostate carcinoma) GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- IKZF2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IKZF2_HUMAN | -0.16 | 1.49 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP arthritis including non-rheumatoid, hdl cholesterol, height, multiple sclerosis, schizophrenia, systolic blood pressure (sbp), triglycerides
PheWAS abnormal findings examination of lungs, abnormal reflex, acute cystitis, acute posthemorrhagic anemia, allergic rhinitis, alopecia, anorexia, aphakia and other disorders of lens, appendicitis, asthma, benign neoplasm of other endocrine glands, benign neoplasm of respiratory and intrathoracic organs, bronchitis, choroidal degenerations, chronic pharyngitis and nasopharyngitis, chronic sinusitis, chronic venous hypertension, corneal degenerations, cystitis and urethritis, delirium due to conditions classified elsewhere, depression, diffuse diseases of connective tissue, diseases of hair and hair follicles, diseases of the salivary glands, disorders of choroid, disorders of cornea, disorders of lacrimal system, disorders of optic nerve and visual pathways, dry eyes, duodenal ulcer, dysthymic disorder, epistaxis or throat hemorrhage, eustachian tube disorders, fracture of lower limb, fracture of neck of femur, genital prolapse, gross hematuria, hemorrhage from gastrointestinal ulcer, hypertensive chronic kidney disease, hypertensive heart and/or renal disease, hypoglycemia, hypopotassemia, hypotension nos, inflammatory disease of breast, known or suspected fetal abnormality, left bundle branch block, lipoma, mechanical complication due to other implant and internal device, megaloblastic anemia, mood disorders, myeloid leukemia, nasal polyps, neoplasm of uncertain behavior, obesity, obstructive sleep apnea, other cardiac conduction disorders, other disorders of bladder, other disorders of the nervous system, other hypertensive complications, pain in limb, pericarditis, pernicious anemia, primary thrombocytopenia, prolapse of vaginal walls, prostate cancer, scar conditions and fibrosis of skin, scleritis and episcleritis, sensorineural hearing loss, sleep apnea, spermatocele, stress incontinence, female, systemic lupus erythematosus, uterine leiomyoma, uterine/uterovaginal prolapse, vascular disorders of penis, viral infection
GTEx eQTL Adipose_Subcutaneous, Brain_Caudate_basal_ganglia, Brain_Cerebellum, Brain_Cortex, Cells_Cultured_fibroblasts, Colon_Transverse, Lung, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood