rs308698 chr3:161770560 A>T
- Sequence
caggaaaagtggaccacaatatgt[A/T]ccgtgctagttatgcccactggga
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | -0.42 | 2.02 | 1.17 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP college completion, type 1 diabetes, rheumatoid arthritis, crohns disease, combined case analysis