rs309136 chr2:136008354 A>T
- Sequence
tcaccacatcatgtgctgccagtc[A/T]tcacttctgctgttgccaccaacc
- ASB in cell types
- R3/R4 erythroid cells
- ASB for transcription factors
- NFE2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NFE2_HUMAN | 3.14 | -3.13 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1