rs3093030 chr19:10286727 C>T
- Sequence
caagaaaacattgtgggttgatgg[C/T]cataccctgaggttctggtccaaa
- ASB in cell types
- K562 (myelogenous leukemia) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.90 | 0.30 | 2.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.35 | 0.78 | 1.16 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), college completion, coronary artery disease (cad), plasma soluble intercellular adhesion molecule 1 (icam-1) (females), rheumatoid arthritis, soluble intercellular adhesion molecule 1 (icam-1), urinary albumin-to-creatinine ratio
PheWAS abnormal chest sounds, abnormal sputum, adjustment reaction, adverse effects of antirheumatics, antihypertensive agents causing adverse effects, aortic aneurysm, atrial flutter, atrophic gastritis, benign neoplasm of other endocrine glands, blood vessel replaced, cachexia, calculus of lower urinary tract, cardiac complications, not elsewhere classified, cellulitis and abscess of foot/toes, coagulation defects, complication of amputation stump, complications of gastrostomy, colostomy and enterostomy, congenital anomalies of posterior segment of eye, congenital coagulation defects, congenital musculoskeletal anomalies, deficiency anemias nos, delirium dementia and amnestic disorders, digestive congenital anomalies, disorders of conjunctiva, disorders of external ear, disorders of menstruation, disorders of sacrum, disturbances of amino-acid transport, disturbances of sulphur-bearing amino-acid metabolism, dysthymic disorder, h. pylori, hearing loss, hematemesis, hemoptysis, hemorrhage nos, hypocalcemia, hypoparathyroidism, infections involving bone, irregular menstrual cycle, irregular menstrual cycle/bleeding, irritable bowel syndrome, lack of coordination, mood disorders, other conditions of brain, nos, other diseases of lung, other immunological findings, other specified erythematous conditions, otosclerosis, pain in joint, paralytic ileus, paranoid disorders, peptic ulcers, peripheral enthesopathies, pervasive developmental disorders, phobia, postlaminectomy syndrome, postmenopausal bleeding, prostate cancer, pyogenic arthritis, salicylates causing adverse effects in therapeutic use, schizophrenia, seborheic dermatitis, sensorineural hearing loss, sleep apnea, subarachnoid hemorrhage, symptomatic artificial menopause, symptoms associated with female genital organs, toxic effect of venom, type 1 diabetic neuropathy, ulcer of esophagus, unspecified polyarthropathy or polyarthritis, upper gastrointestinal congenital anomalies, ventral hernia
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Thyroid