rs309455 chr9:37432267 T>C
- Sequence
gaacccaaagggacacaccaggga[T/C]cgtaaatgtttatgttgtcagtga
- ASB in cell types
- Mutu-1 (Epstein-Barr virus-related Burkitt lymphoma)
- ASB for transcription factors
- COE1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| COE1_HUMAN | n/a | 2.99 | 1.50 | 1.39 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP ldl cholesterol, resistance to kuru in aged women despite likely exposure, tetrology of fallot
GTEx eQTL Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Lung, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Thyroid, Whole_Blood