rs3098325 chr2:230864733 C>T
- Sequence
tgagtgagtgagtgagtgagcgag[C/T]gagtgagtgactgtgcgagcgagc
- ASB in cell types
- GM10847 (female B-cells Lymphoblastoid Cell Lines) foreskin keratinocyte GM12878 (female B-cells lymphoblastoid cell line) GM19099 (female B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM10847 (female B-cells Lymphoblastoid Cell Lines) | -1.04 | 1.48 | 1.00 | |||
| foreskin keratinocyte | n/a | 1.53 | 2.25 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.85 | 0.74 | 1.11 | |||
| GM19099 (female B-cells Lymphoblastoid Cell Lines) | -1.15 | 1.31 | 1.00 |
Items per page:
1 – 4 of 4