rs310166 chr1:60765375 T>G
- Sequence
tcacaagggtacttggcaagtgaa[T/G]ggcaagctaatgaatgccccctac
- ASB in cell types
- K562 (myelogenous leukemia) thyroid gland HMEC (human mammary epithelial cells) Peyer's patch
- ASB for transcription factors
- REST_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| REST_HUMAN | n/a | 3.17 | 2.00 | n/a | No Hit | |||
| STAG1_HUMAN | 1.34 | -0.14 | 1.24 | n/a | n/a |
Items per page:
1 – 2 of 2