rs3104051 chr10:69801243 G>A
- Sequence
tacctcaggtcttggtcctgagag[G/A]aagggctgccagctctgctgcccc
- ASB in cell types
- PANC1 (pancreatic ductal adenocarcinoma)
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 0.25 | 1.23 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder, hdl cholesterol, ldl cholesterol, serum creatinine, stabilized warfarin dose, total cholesterol, triglycerides