rs3104182 chr6:170148114 G>A
- Sequence
ggtgcccagagactgctgctctcc[G/A]ctggttgggccctaaatccaccct
- ASB in cell types
- MOLM14 (Adult acute myeloid leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MOLM14 (Adult acute myeloid leukemia) | n/a | 1.89 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Breast_Mammary_Tissue, Colon_Transverse, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Stomach