rs311395 chr8:54166316 G>A
- Sequence
tggaaaagtaggttttgttatcac[G/A]aagtgaatgtagccggctcaaaat
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) OCI-LY7 (diffuse large B-cell lymphoma) GM12878 (female B-cells lymphoblastoid cell line) KMS-11 (Plasma cell myeloma)
- ASB for transcription factors
- FOXP1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXP1_HUMAN | 2.28 | -4.12 | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1