rs3116597 chr13:50512228 G>C
- Sequence
agaatttggaaaaaaaaaaaaaaa[G/C]cttgctactaggtcacttagaaga
- ASB in cell types
- MOLT-4 (Adult T acute lymphoblastic leukemia) MS-1 (Small cell lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MOLT-4 (Adult T acute lymphoblastic leukemia) | 0.19 | 1.33 | 1.00 | |||
| MS-1 (Small cell lung carcinoma) | -1.24 | 1.65 | 1.00 |
Items per page:
1 – 2 of 2