rs312985 chr2:21155933 A>G
- Sequence
tttgggtatcaggagctgcattct[A/G]gcacttgtttacctctgtggatta
- ASB in cell types
- HepG2 (hepatoblastoma)
- ASB for transcription factors
- BCL6_HUMAN FOXA2_HUMAN FOXP1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BCL6_HUMAN | 3.19 | n/a | 2.00 | n/a | No Hit | |||
| FOXA2_HUMAN | 1.24 | -4.33 | 2.00 | n/a | No Hit | |||
| FOXP1_HUMAN | 1.32 | -3.39 | 2.00 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP apob (apolipoprotein b), coronary artery disease (cad), hdl cholesterol, ldl cholesterol, ldl cholesterol change with statins, ldl cholesterol total lipoprotein fraction concentration in fasting sample, parkinsons disease, total cholesterol, triglycerides
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg