rs313478 chr10:4533615 C>T
- Sequence
tgtttcttgggcactgcacattta[C/T]agtgttatcagcatatacatttat
- ASB in cell types
- HS-SY-2(Monophasic synovial sarcoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HS-SY-2(Monophasic synovial sarcoma) | 0.09 | 1.54 | 1.25 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP arthritis including non-rheumatoid, birth weight, body mass index (bmi), hdl cholesterol change with statins, longstanding arthritis, sporadic creutzfeldt-jakob disease, total cholesterol, urinary albumin-to-creatinine ratio