rs313853 chr19:46784682 T>C
- Sequence
tttgggggcccgcctgcacgcaaa[T/C]acagcccctactcatgcctcagcc
- ASB in cell types
- HEK293 (embryonic kidney) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.73 | 0.41 | 1.71 | |||
| foreskin keratinocyte | 1.56 | -0.39 | 1.78 |
Items per page:
1 – 2 of 2