rs31565 chr5:135880423 G>A
- Sequence
tttaccttcactgtgcagatgcaa[G/A]tgacccaggctcacaagtgaggac
- ASB in cell types
- GM19193 (female B-cells Lymphoblastoid Cell Lines) GM12891 (male B- cells lymphoblastoid cell line) SK-N-SH (neuroblastoma) foreskin keratinocyte
- ASB for transcription factors
- STAG1_HUMAN CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | -0.32 | 1.64 | 1.00 | n/a | n/a | |||
| CTCF_HUMAN | 0.29 | 1.31 | 1.32 | n/a | No Hit |
Items per page:
1 – 2 of 2