rs315763 chr5:170339425 T>C
- Sequence
gccttgggttgggtttgtcccagc[T/C]cctgccctggttgggggtgagggg
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.07 | 0.80 | 1.12 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP chronic kidney disease, homa-ir, serum creatinine, total cholesterol change with statins, triglycerides change with statins