rs318443 chr6:2926064 A>T
- Sequence
taggccagatttatctttcacttt[A/T]cataaacatctcagtgtagcaaag
- ASB in cell types
- embryonic stem cells derived definitive endoderm definitive endoderm from HUES8 WA09 (embryonic stem cells)
- ASB for transcription factors
- GATA6_HUMAN AP2A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA6_HUMAN | 1.30 | 0.13 | 1.11 | n/a | No Hit | |||
| AP2A_HUMAN | 2.38 | -2.07 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2