rs318461 chr6:2940398 T>C
- Sequence
tagtggtaacccgttggggttttc[T/C]gtgctgtgataaggtttgttcgtt
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) CAR-T cells
- ASB for transcription factors
- ATF7_HUMAN JUN_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ATF7_HUMAN | -2.01 | 2.41 | 1.00 | n/a | n/a | |||
| JUN_HUMAN | 2.36 | -2.38 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood