rs321655 chr18:8624153 A>G
- Sequence
gttcctgtagggaaggtgcctcta[A/G]ttctaaattcagccagcatccctt
- ASB in cell types
- MDM(monocyte derived macrophages)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MDM(monocyte derived macrophages) | -0.88 | 1.89 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP birth weight, irritible bowel syndrome, salmonella-induced pyroptosis, triglycerides:hdl cholesterol ratio