rs323176 chr7:78709890 T>G
- Sequence
gctccctcataacttcccagtatt[T/G]accctgtacagcatgtttctcttg
- ASB in cell types
- LNCaP (prostate carcinoma) HepG2 (hepatoblastoma) primary prostate cancer
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LNCaP (prostate carcinoma) | 1.89 | -0.25 | 1.86 | |||
| HepG2 (hepatoblastoma) | -0.45 | 1.42 | 1.56 | |||
| primary prostate cancer | -0.94 | 2.31 | 2.00 |
Items per page:
1 – 3 of 3