rs324639 chr7:137003903 G>A
- Sequence
catgagatctgatgatttgataag[G/A]ggcttttccccttttgctcggcac
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia) embryonic stem cells derived definitive endoderm
- ASB for transcription factors
- SPI1_HUMAN GATA4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 0.57 | 1.07 | 1.00 | 0.45 | Weak Concordant | |||
| GATA4_HUMAN | 2.37 | 0.26 | 1.00 | 0.90 | Weak Discordant |
Items per page:
1 – 2 of 2
Motif analysis
