rs3263 chr17:1005555 G>A
- Sequence
gagctttcaaggcgatggagcgaa[G/A]accaagggtgcacatgcatgcagg
- ASB in cell types
- MOLT-4 (Adult T acute lymphoblastic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MOLT-4 (Adult T acute lymphoblastic leukemia) | 1.65 | 0.39 | 2.00 |
Items per page:
1 – 1 of 1