rs327086 chr4:186723962 A>C
- Sequence
ctttccccggctgccggctctggg[A/C]ccgcgggctcggccacgcagtccc
- ASB in cell types
- MCF10A (breast epithelial cells) iPS-derived dermal fibroblasts
- ASB for transcription factors
- LIN9_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| LIN9_HUMAN | 1.73 | -1.15 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adrenal_Gland, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Muscle_Skeletal, Thyroid