rs327264 chr5:38653499 T>G
- Sequence
tgaagaaagcagttagcagacatt[T/G]gaatgtcacaaggttgagaatgtg
- ASB in cell types
- LHSAR (prostate epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LHSAR (prostate epithelial cells) | -1.70 | 1.44 | 1.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), fasting blood glucose, parkinsons disease, refractive error, resistance to kuru in aged women despite likely exposure, systolic blood pressure (sbp), transmission distortion
GTEx eQTL Artery_Tibial, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Testis, Thyroid