rs328409 chr19:34346105 A>T
- Sequence
ggcaaaatcagtgcgggatgggga[A/T]cgggagacaggccagcatgactga
- ASB in cell types
- HMEC (human mammary epithelial cells) 22RV1 (prostate carcinoma) HEK293 (embryonic kidney) thyroid gland
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HMEC (human mammary epithelial cells) | 2.35 | -2.04 | 1.00 | |||
| 22RV1 (prostate carcinoma) | 1.38 | 0.31 | 1.50 | |||
| HEK293 (embryonic kidney) | 1.00 | 0.43 | 4.61 | |||
| thyroid gland | -1.33 | 1.59 | 1.00 | |||
| erythroid progenitors | 2.02 | n/a | 2.50 |
Items per page:
1 – 5 of 5