rs329363 chr9:36556094 G>A
- Sequence
aaacactgctgtgagatcccagac[G/A]gcaggacttgtcctcttcattgaa
- ASB in cell types
- HMEC (human mammary epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HMEC (human mammary epithelial cells) | 1.71 | -1.32 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP diastolic blood pressure (dbp), infant head circumference, ldl cholesterol, partial epilepsy, total cholesterol, triglycerides change with statins