rs333947 chr1:109928142 G>A
- Sequence
ggggatttctgctctgggaacaaa[G/A]cgtcctgaggatgctgggcaagag
- ASB in cell types
- BEAS-2B (bronchial epithelium) 22RV1 (prostate carcinoma)
- ASB for transcription factors
- GCR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GCR_HUMAN | 0.44 | 0.70 | 1.11 | 0.93 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
EMBL-EBI aspartate aminotransferase levels, creatine kinase levels, high density lipoprotein cholesterol levels, lactate dehydrogenase levels, monocyte count, serum total protein level, white blood cell count
GRASP adiponectin levels, coronary artery disease (cad), fasting blood glucose, hdl cholesterol, hdl cholesterol change with statins, homa-b, hypertension (early onset hypertension), pulmonary arterial hypertension (pah), triglycerides, type 1 diabetes, combined control dataset, waist hip ratio
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg