rs33423 chr5:72584709 A>G
- Sequence
tattgagaaactaggtcaatcatc[A/G]tctaactaagagcctcctattgaa
- ASB in cell types
- GM19240 (B cells Lymphoblastoid Cell Lines)
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 0.56 | 1.11 | 1.17 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP abnormal involuntary movement scale, ldl cholesterol change with statins, obesity with early age of onset (age >2), severe diabetic retinopathy, total cholesterol change with statins, triglycerides
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Cortex, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Muscle_Skeletal