rs335678 chr15:75929595 A>G
- Sequence
tgctgctcagtacatagctgcttc[A/G]ttatttgtgttgattgcattattt
- ASB in cell types
- GM19193 (female B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19193 (female B-cells Lymphoblastoid Cell Lines) | 1.91 | -1.31 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, college completion, cystatin c in serum, ldl cholesterol, serum creatinine, total cholesterol, years of education
GTEx eQTL Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Prostate, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid