rs336545 chr3:161342719 C>T
- Sequence
gccatcatcttacagtataaatga[C/T]atcacattccttgcacatcacccc
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 1.04 | -0.11 | 2.12 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP hip bone mineral density (bmd), late onset alzheimers disease, stabilized warfarin dose, total cholesterol, waist hip ratio, years of education
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Brain_Cerebellar_Hemisphere, Colon_Sigmoid, Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid