rs337259 chr5:69094457 C>T
- Sequence
cccggggtcggcgcgccctctccc[C/T]ctgcctgcctccctgcgcgcaggc
- ASB in cell types
- HepG2 (hepatoblastoma) MDA-MB-231ERb(triple negative breast cancer)
- ASB for transcription factors
- TYY1_HUMAN ESR2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TYY1_HUMAN | -1.14 | 2.02 | 1.00 | n/a | No Hit | |||
| ESR2_HUMAN | 0.02 | 1.47 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Thyroid