rs338933 chr1:58392177 G>C
- Sequence
aagagctaagcgcagagttgaggg[G/C]aagaaagataagctcaaattttct
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- ENL_HUMAN ELF1_HUMAN IKZF2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ENL_HUMAN | 2.19 | n/a | 1.75 | n/a | n/a | |||
| ELF1_HUMAN | 2.38 | n/a | 1.00 | n/a | No Hit | |||
| IKZF2_HUMAN | 2.08 | -1.64 | 1.00 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP birth weight, chronic kidney disease, ldl cholesterol change with statins, total cholesterol change with statins