rs339392 chr19:6722011 G>T
- Sequence
tttcacctcagtgagcaaagaact[G/T]cctcattcttacaggttacaggcc
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- TADBP_HUMAN IKZF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TADBP_HUMAN | n/a | 3.00 | 1.00 | n/a | n/a | |||
| IKZF1_HUMAN | n/a | 2.49 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi) (within family tests), cystatin c in serum, fasting insulin, homa-b, homa-ir, prop taste detection threshold
GTEx eQTL Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Esophagus_Mucosa, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Pituitary, Testis, Thyroid, Whole_Blood