rs339567 chr1:194873604 T>C
- Sequence
gataagagaaatcgcttgatgaca[T/C]gagccacgcctaaaaggctgaagc
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- CEBPB_HUMAN E2F1_HUMAN ATF3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CEBPB_HUMAN | -0.23 | 3.74 | 2.25 | n/a | No Hit | |||
| E2F1_HUMAN | n/a | 2.11 | 5.00 | n/a | No Hit | |||
| ATF3_HUMAN | n/a | 2.51 | 3.00 | -1.77 | Weak Discordant |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), diabetic retinopathy in type 2 diabetes mellitus, infant head circumference, serum creatinine, triglycerides