rs340046 chr5:145825917 T>G
- Sequence
taacctgaatattcatgttttaat[T/G]catgaaaatttaccaaaactccca
- ASB in cell types
- Peyer's patch neural cell HeLa Kyoto (cervical adenocarcinoma) Jurkat (T-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| Peyer's patch | 0.32 | 1.08 | 1.00 | |||
| neural cell | 0.48 | 0.96 | 1.00 | |||
| HeLa Kyoto (cervical adenocarcinoma) | 1.69 | 0.08 | 2.00 | |||
| Jurkat (T-cells) | 1.84 | -0.02 | 1.00 | |||
| adult erythroblasts | n/a | 1.61 | 3.00 |
Items per page:
1 – 5 of 6