rs340772 chr2:16282094 T>C
- Sequence
ctcctgtctgattcttggttcctc[T/C]cttcctccagaaactaggctgaaa
- ASB in cell types
- GBM39 (Human brain tumor) heart left ventricle MS-1 (Small cell lung carcinoma) Loucy (adult T acute lymphoblastic leukemia)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.02 | 0.73 | 1.25 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder, diabetic retinopathy in type 2 diabetes mellitus, lp-pla2 activity, obesity with early age of onset (age >2), total cholesterol