rs340836 chr1:213989726 C>T
- Sequence
tctggtgtgccagcccgttactcc[C/T]cctgctgaagctgaaggttggtgg
- ASB in cell types
- HEK293 (embryonic kidney) HepG2 (hepatoblastoma)
- ASB for transcription factors
- PRD10_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PRD10_HUMAN | 2.11 | n/a | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adrenal_Gland, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Brain_Putamen_basal_ganglia, Colon_Transverse, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Pancreas, Pituitary, Prostate, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid