rs340892 chr9:6098662 T>G
- Sequence
cccaggcaaactcaggatgtggaa[T/G]aatccatggatggagaaattgtat
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HUVEC-C (HUVEC, umbilical vein endothelial cells) | 2.27 | -1.33 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP arthritis including non-rheumatoid, asthma, birth weight, chronic kidney disease, hdl cholesterol, ldl cholesterol, refractive error, rheumatoid arthritis, total cholesterol
GTEx eQTL Adipose_Visceral_Omentum, Cells_Cultured_fibroblasts, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Whole_Blood