rs34106818 chr17:51439698 C>G
- Sequence
ctccgtttcctgttggttctgttt[C/G]cttcctattaaattactgaactgt
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells) LNCaP C4-2B (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HUVEC-C (HUVEC, umbilical vein endothelial cells) | 2.13 | -1.40 | 2.00 | |||
| LNCaP C4-2B (prostate carcinoma) | -1.53 | 1.81 | 1.00 |
Items per page:
1 – 2 of 2