rs341459 chr15:60788136 C>T
- Sequence
tcggtggggatgtgacatttgagc[C/T]gagacaggaaggatgctgaaagca
- ASB in cell types
- MS-1 (Small cell lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MS-1 (Small cell lung carcinoma) | -0.37 | 1.20 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP birth weight, chronic kidney disease, diastolic blood pressure (dbp), hypertension (early onset hypertension), ldl cholesterol, systolic blood pressure (sbp), tourettes syndrome, transmission distortion