rs34170733 chr7:1333040 C>G
- Sequence
gctgaggcaggagaatggcgtgaa[C/G]ccaggaggcggagcttgcggtgag
- ASB in cell types
- J-Lat A72
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| J-Lat A72 | -3.08 | 2.77 | 1.00 |
Items per page:
1 – 1 of 1