rs341809 chr8:49129998 G>A
- Sequence
agtctagtcgtatgacataattac[G/A]tcattgggaacttctggatttcaa
- ASB in cell types
- HepG2 (hepatoblastoma)
- ASB for transcription factors
- ATF2_HUMAN CREB1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ATF2_HUMAN | 4.75 | n/a | 1.00 | -0.05 | Weak Concordant | |||
| CREB1_HUMAN | 2.81 | -1.61 | 2.67 | -4.88 | Concordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cerebellum, Brain_Cortex, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Muscle_Skeletal, Nerve_Tibial, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid