rs34205788 chr1:47764474 T>A
- Sequence
ccgaggggctaaagtctctcggag[T/A]ccctgtcacctgcctccccacttg
- ASB in cell types
- SU-DHL-2 (anaplastic large cell lymphoma)
- ASB for transcription factors
- ITF2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ITF2_HUMAN | -5.02 | 3.13 | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1