rs34214025 chr1:223628350 A>G
- Sequence
gtccagggtctgcgtttgtgcatc[A/G]gagaacttgcccagcgccacctag
- ASB in cell types
- T47D (invasive ductal carcinoma) MS-1 (Small cell lung carcinoma) MCF10CA1a (breast metastatic epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| T47D (invasive ductal carcinoma) | 1.32 | 0.49 | 1.00 | |||
| MS-1 (Small cell lung carcinoma) | 1.10 | -1.56 | 1.00 | |||
| MCF10CA1a (breast metastatic epithelial cells) | 1.97 | -1.63 | 1.00 |
Items per page:
1 – 3 of 3